naveyah28p87sar naveyah28p87sar

04-05-2018
Chemistry

contestada

A carbon-carbon triple bond is found in a molecule of

Respuesta :

torigraybeal torigraybeal

04-05-2018

A triple bond is a type of covalent bond. It involves a sigma bond and two pi bonds (each bond involves 2 electrons). A carbon atom is capable of 4 bonds...a carbon-carbon triple bond is found in all alkynes.

Answer Link

Otras preguntas

What is the elapsed time

The name for people who stay in one place like civilization of china and kroea

An increase in immigrants to Texas led to _________ education. A. extracurricular B. higher C. mandatory D. bilingual

What was the result of the anti-nephi-lehies becoming converted unto the lord?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The length of a rectangular garden is 4 m greater than the width. the area of the garden is nbsp 60m squared . find the dimensions of the garden.

crystal lattice definition

Do you think social mobility is an easy thing to achieve in the US? Why or why not?

__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging

A mixture from which some of the particles settle out slowly upon standing