rosiebui95
rosiebui95 rosiebui95
  • 02-03-2018
  • Mathematics
contestada

Please help me with this question

Please help me with this question class=

Respuesta :

evgeniylevi
evgeniylevi evgeniylevi
  • 02-03-2018
Try this option:
1. S=12²-10²=44 sq. ft.
2. S=10*12-6*8=120-48=72 sq. ft.

answers: 1-C; 2-C.
Answer Link

Otras preguntas

What is the main reason night driving is more difficult than daytime driving?
Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.
Homosociality reflects children's tendency to prefer social interactions with
Mark bought a set of 6 flower pots of different sizes at a total cost of $8.25. each pot cost $0.25 more than the next one below it in size. what was the cost,
help me asap !!!!!!!!
PLEASE HELP!!!!!!!! Which of the following is a continuous random variable? A) the number of employees in an office B) the salaries of employees in an off
3∙(a+x), if a=8; x=−10
does mercury have a magnetic field
when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat