retro55
retro55 retro55
  • 04-01-2018
  • English
contestada

Which sentence provides the best analysis of a story's setting?

Respuesta :

Ari1208
Ari1208 Ari1208
  • 04-01-2018
One that uses vivid imagery and historical insight.
Answer Link

Otras preguntas

pls help its urgent, ty!
¿por que biomasa es una energía limpia y renovable, si al final los productos como biodiesel e los pellets se queman y esa combustión produce gases de efecto in
What had the largest positive impact on literacy rates in Europe in the mid 1400s? Group of answer choices A. Illumination made works of literature extremely be
How does radiation differ from conduction? Flvs question ASAP
(02.02) The table below shows a correct representation that 12 pounds (lb) of sugar cost $4:
pls help im confused with this
John is making an experiment for class. The equation H=-0.3m+16.4 models the relationship between the height of a candle in centimeters. H is the time the candl
3. What is the kinetic energy of an object that is not in motion? depends on how large the object is depends on the potential energy 00 O ME
If my measurement is 2.34 cm and the ACTUAL value is 2.35 cm, is my measurement accurate?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'