aliciaflav aliciaflav
  • 03-06-2017
  • Chemistry
contestada

What is the volume in milliliters of 6.58g of acetone

Respuesta :

dec77cat dec77cat
  • 03-06-2017
m=6.58 g
ρ=0.7899 g/ml

v=m/ρ

v=6.58g/(0.7899g/ml)=8.33 ml
Answer Link
JavierCollante
JavierCollante JavierCollante
  • 03-06-2017
we are missing information here. to convert mass (grams) to mL (volume) we need density

since it was not given, i look it up online. density= 0.791 g/mol

density formula---> density= mass/ volume

we can rewrite this formula to solve for volume

volume= mass/ density

volume= 6.58 grams/ 0.791 = 8.32 mL
Answer Link

Otras preguntas

Help pl0x, Algebra 1
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
how can you write 0.45 as fraction and a percentage ,please show work
how do i find the angles on a kite?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Round 46.895 to the nearest tenth