raymonh211 raymonh211

02-03-2021
History

contestada

what was the geographic advantage of the battle of Thermopylae

Respuesta :

ntrisha10 ntrisha10

02-03-2021

Answer:

It was an excellent choice of defense because the mountains ran down the seas which left way for only a narrow pass near the coast.

Explanation:

See answer. Explanation included in answer above

Answer Link

Otras preguntas

which of the following harvesting methods is used in large farmhouses a)sickle b)oxen trampling c)combine d)thresher

What brings the u.s. into this war? - 1. economic factors (natural resources and new markets 2. nationalistic factors (competition to create an empire/prove you

The tendency for people to become more extreme in their attitudes as a result of group discussion is called _______.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The available farmland in Mali is in the northeast. True or false

U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?

The learning curve describes the ________ relationship between ________ and ________

What caused the gross domestic product of the united states to quadruple between 1860 and 1890?

What body systems are used to pick up a pencil and write down a few sentences in the space below? Fingers, Hand and arms is not what I’m looking for.

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used In one serving