kmbroadus kmbroadus
  • 01-11-2020
  • History
contestada

Why were immigrant families forced to take low paying industrial jobs in late 2800s

Respuesta :

dselevany
dselevany dselevany
  • 01-11-2020
Immigrants were not really accepted in America so Low paying and unsafe jobs were left for them to grab. Immigrants and slaves fought for these jobs. They also lacked skill and were for the most part not educated.
Answer Link

Otras preguntas

What is the additive inverse of -4a
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
Did feudalism create a stable form of government?
what is 0.00001267 is scientific notation
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Companies raise funds to expand their business by