marleyscott
marleyscott marleyscott
  • 02-09-2020
  • Mathematics
contestada

Solve for n.
d=5m +9n

Respuesta :

nermay7
nermay7 nermay7
  • 02-09-2020

Answer: n= [tex]\frac{d}{9} - \frac{5m}{9}[/tex]

Step-by-step explanation:

d= 5m + 9n   try to get 9n alone by subtracting 5m from both sides

d -5m = 9n   Now divide both sides by  9 to get  n alone

n = [tex]\frac{d}{9} - \frac{5m}{9}[/tex]  

Answer Link

Otras preguntas

7. Star light provides information about the star's A. age. B. speed. C. temperature.
2. There are 28 tables in the cafeteria. Each table has 12 students sitting at it. Fourth graders sit at 13 of the tables. Fifth graders sit at the rest of the
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What was the purpose of the vinegar In the third trial? A) test the effect of raising pH on enzyme action B)served no purposeC) serve as a control D) test the e
How does the Law of Conservation of Matter apply to you when you eat food? Why do you not continuously gain exactly the amount of mass you consume with each mea
Please help me thanksssssss lol I have so much questions
I NEED HELP FASTTTTTTT
please help ....posting more questions..​
who was abraham's wife
What is the government telling us? Why would they put these values on our coins? What do you think about all of this?