nommies005
nommies005 nommies005
  • 02-09-2020
  • Mathematics
contestada

Solve this system of equations and enter an ordered pair (x,y). y = x + 3 y = -x - 5

Respuesta :

kalibh kalibh
  • 02-09-2020

Answer:

(x,y). y = x + 3 y = -x - 5

Step-by-step explanation:

  • add it up cowgirl howdey with PHOTOT MATHS
Answer Link
Аноним Аноним
  • 02-09-2020

Answer:

(-4,-1)

Step-by-step explanation:

I graphed the two lines using a graphing tool. When graphed, the lines intercept at (-4,-1). Therefore, (-4, -1) is the solution.

Please see the graph attached.  

Hope this helps.

Ver imagen Аноним
Answer Link

Otras preguntas

What is the First Language On world?
A mudflow consists of debris with a large amount of
Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a
What are at least three differences between apes and humans in the cranium and teeth?
Which of the following can be a cause of social change?
U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The test scores for a group of students are shown. 89, 74, 100, 86, 74, 67, 86, 72, 60, 93, 83, 86 What is the median of the scores?
[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of
1. use the graph of y = sin θ to find the value of sin θ for each value of θ. 270°please help