jazmines77 jazmines77
  • 01-09-2020
  • Mathematics
contestada

is 4 to 7 the same as 7 to 4? Explain why or why not.​

Respuesta :

isaacmr isaacmr
  • 20-11-2020

Answer:

No, 4 to 7 is not the same as 7 to 4.

Order is important when writing a ratio.

The ratio compares the first quantity to the second.

The ratio 4 to 7 means there are more of the second quantity, but 7 to 4 means there are more of the first.

Step-by-step explanation:

Answer Link

Otras preguntas

Which body tissue or organ contains the most mitochondria?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
how do i find the angles on a kite?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
What was George Washington's nickname?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
How many years does an apple tree live useful?
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources