mochaFrappuccino07 mochaFrappuccino07

04-05-2020
Mathematics

contestada

square root of 899 please give me the right answer.

Respuesta :

Аноним Аноним

04-05-2020

Answer:

29.98332

Step-by-step explanation:

Answer Link

Otras preguntas

2x – 3y = -1 11x - 9y = -13

Here is an inequality: -2x > 10. List some values for x that would make this inequality true. AT least 2

Write either 'al', 'a la' or 'en' in the blank. Mi padre va ----------- tienda. Vamos------------- gimnasio. Voy ------------------ teatro. Estás --------------

Relationships with family, friends, and community far outweigh money or things. Which of the following indicators would most likely use the statement above as

A "home-made" solid propellant rocket has an initial mass of 9 kg; 6.8 kg of this is fuel. The rocket is directed vertically upward from rest, burns fuel at a c

Select the correct answer. French soldiers fall at Napoleon's feet with French flag waving behind him Look at Charles de Steuben’s nineteenth-century painting o

What organism is penicillin derived from ?

Miranda and her uncle see an interesting new car drive by. Later, after the car has gone, her uncle asks if she remembers the neat thing they saw minutes before

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

write a essay on nature has remedy for all