AUTUMNDAWNSKY AUTUMNDAWNSKY

03-10-2014
Mathematics

contestada

A bakery baked 184 loaves of bread in 4 hours. how many miles and 1 hour

A bakery baked 184 loaves of bread in 4 hours how many miles and 1 hour class=

Respuesta :

Аноним Аноним

08-10-2014

(184 loaves)/(4 hours) = rate of loaves baked per hour

184/4 = 46

Answer:

46 loaves/hour

Answer Link

Otras preguntas

What was a major effect of the agricultural revolution in the united states during the late 1800's?

I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;

A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

As the mother of a late-maturing boy, betty is concerned because, when compared to early-maturing boys, late maturers are more likely to ________.

Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.

NEED HELP WORTH 50 POINTS !! Holly has a rectangular garden that measures 12 m wide by 14 m long. She wants to increase the area to 255 m2 by increasing the wi

Gerri says that a spider use their fangs for the same purpose that crustaceans use their claws. Alana disagrees and says that spiders use their fangs for the s

Please help me out with this

Mrs. Collins is at the table with you and states that the fourth-degree graphs she has seen have four-real zeros. She asks you if it is possible to create a fou