tatanishafulmore tatanishafulmore
  • 03-05-2019
  • Mathematics
contestada

Jack earns $300 per week selling cars. He makes an additional 2% commission on all of his sales. Last week he sold $53, 850 worth of cars. What was Jack’s income for the week?

Respuesta :

pranav109503
pranav109503 pranav109503
  • 03-05-2019

Answer:

1377 dollars

Step-by-step explanation:

Answer Link

Otras preguntas

lest to greatest fractions 2/5 7/8 8/10 3/4
Over time, a river cut through a field where some mice lived and some birds were nesting. Tell over time why the mice developed into 2 different species, but t
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
In a large population, 70 % of the people have been vaccinated. If 3 people are randomly selected, what is the probability that AT LEAST ONE of them has been va
When a chemical recstion has oxygen what does it clasify as
14a. Give an example of an industry which requires skilled labor.
What is the common ratio of the sequence? -2, 6, -18, 54,... 0 -3 O -2 3 08
what is the 50th term of the linear sequence below 27,25,23,21,19...
PLZZ HELP QUICK, THANKS!What is the relationship between genes and alleles?A. Genes carry instructions for proteins that express traits. Alleles are alternative
Which of the following is NOT a class of annelid?