tayflyswag tayflyswag
  • 04-03-2019
  • English
contestada

The ________ to a nonfiction work typically identifies the topic of the work and the main claim the writer is making.A. body B. conclusion C. analysis D. introduction

Respuesta :

130005401 130005401
  • 04-03-2019

The correct answer is introduction

Answer Link

Otras preguntas

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Explain who or what "Año Viejo" is and its significance.
How much money, in dollars, does one mole of nickels represent?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
round 7,782 to the nearest hundred