bdesherl69 bdesherl69
  • 03-10-2018
  • Mathematics
contestada

Determine the equation of the inverse of p (x) =sqrt 5x+7?

Respuesta :

keelingbrett keelingbrett
  • 08-10-2018

the answer is 7+5x because when you inverse something you reverse it.

Answer Link

Otras preguntas

Why would Pasteur have boiled the meat broth before even starting the experiment?​
⎪6 − 4⎪ − ⎪3 − 8⎪ = ? Please help!!!!
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
How do i find out if 1/32 is a density property
11/9 rational or irrational
how can youth are been able to obtain good job and good working condition in other countries​
What is a example of a colloid you can see threw?
The Judicial Branch is in charge of creating the laws of the United States. True or False
Would I have to add all of them or multiply I can’t remember how to do it nor if I actually learned this.
having an arena with bandwidth that is stronger than the average event venue is one way that the atlanta hawks have ______________________ their market offering